View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0739_high_13 (Length: 264)
Name: NF0739_high_13
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0739_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 118 - 220
Target Start/End: Complemental strand, 19396041 - 19395939
Alignment:
Q |
118 |
ttgactcctagttagagcactccgctatgcctgtttgtttatgcaacgtgaaaggtttgaatgaattttatttaattttgtacatgaaaaattatactca |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
19396041 |
ttgactcctagttagagcactccgctatgcctgtttgtttatgcaaagtgaaaggtttgaatgaattttatttaattttgtaaatgaaaaattatactca |
19395942 |
T |
 |
Q |
218 |
aaa |
220 |
Q |
|
|
||| |
|
|
T |
19395941 |
aaa |
19395939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 21 - 88
Target Start/End: Complemental strand, 19396604 - 19396537
Alignment:
Q |
21 |
gagcagagagcacacctaacacttccccccaagtctacatctaccaaaggtgaaatccattccgatct |
88 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19396604 |
gagccgagagcacacctaacacttccccccaagtctacatctaccaaaggtgaaatccattccgatct |
19396537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 163 - 220
Target Start/End: Complemental strand, 18167438 - 18167381
Alignment:
Q |
163 |
acgtgaaaggtttgaatgaattttatttaattttgtacatgaaaaattatactcaaaa |
220 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18167438 |
acgtgaaaggtttgaatgaattttatttaattttgtacatgaaaaattatactcaaaa |
18167381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5345 times since January 2019
Visitors: 4850