View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0739_high_16 (Length: 260)
Name: NF0739_high_16
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0739_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 37 - 113
Target Start/End: Complemental strand, 39239321 - 39239246
Alignment:
| Q |
37 |
cagtacagcgggatgtttgtaaatacaaggagctgctctagagttcttgtatttacattgtttttgtagatgtaatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
39239321 |
cagtacagcgggatgtttgtaaatacaaggagctgctctagagttcttgtgtttacattg-ttttgtagatgtaatt |
39239246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University