View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0739_high_16 (Length: 260)

Name: NF0739_high_16
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0739_high_16
NF0739_high_16
[»] chr1 (1 HSPs)
chr1 (37-113)||(39239246-39239321)


Alignment Details
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 37 - 113
Target Start/End: Complemental strand, 39239321 - 39239246
Alignment:
37 cagtacagcgggatgtttgtaaatacaaggagctgctctagagttcttgtatttacattgtttttgtagatgtaatt 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||    
39239321 cagtacagcgggatgtttgtaaatacaaggagctgctctagagttcttgtgtttacattg-ttttgtagatgtaatt 39239246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University