View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0739_high_19 (Length: 253)
Name: NF0739_high_19
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0739_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 13866392 - 13866282
Alignment:
Q |
4 |
agttttaaagagatatggttctggaatttgtatggaaagagatatagttttggaatttgtatggaaaagatattgggaagaagatgggttaggttataca |
103 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
T |
13866392 |
agttttaaagagatatggttctggaatttgtatggaaagagatatagttttggaatttgtatggaaaggatattgggaagaagatgagttaggttataca |
13866293 |
T |
 |
Q |
104 |
tagaaacatga |
114 |
Q |
|
|
||||||||||| |
|
|
T |
13866292 |
tagaaacatga |
13866282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 4 - 114
Target Start/End: Original strand, 44317284 - 44317394
Alignment:
Q |
4 |
agttttaaagagatatggttctggaatttgtatggaaagagatatagttttggaatttgtatggaaaagatattgggaagaagatgggttaggttataca |
103 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
T |
44317284 |
agttttaaagagatatggttctggaatttgtatggaaagagatatggttttggaatttgtatggaaaggatattgggaagaagatgagttaggttataca |
44317383 |
T |
 |
Q |
104 |
tagaaacatga |
114 |
Q |
|
|
||||||||||| |
|
|
T |
44317384 |
tagaaacatga |
44317394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 49528530 - 49528420
Alignment:
Q |
4 |
agttttaaagagatatggttctggaatttgtatggaaagagatatagttttggaatttgtatggaaaagatattgggaagaagatgggttaggttataca |
103 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
T |
49528530 |
agttttaaagagatatggttctggaatttgtattgaaagagatatagttttggaatttgtatggaaaggatattgggaagaagatgagttaggttataca |
49528431 |
T |
 |
Q |
104 |
tagaaacatga |
114 |
Q |
|
|
||||||||||| |
|
|
T |
49528430 |
tagaaacatga |
49528420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 163 - 229
Target Start/End: Complemental strand, 49528371 - 49528305
Alignment:
Q |
163 |
atgaagttctgggttcgtgcatgaattttatgagtttttgggtttttccttgctgttgttgatgatg |
229 |
Q |
|
|
||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
49528371 |
atgaagttctgggtttgtgtatgaattttatgaatttttgggtttttccttgctgttgttgatgatg |
49528305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 163 - 229
Target Start/End: Original strand, 44317443 - 44317509
Alignment:
Q |
163 |
atgaagttctgggttcgtgcatgaattttatgagtttttgggtttttccttgctgttgttgatgatg |
229 |
Q |
|
|
|||||||||| |||| ||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
44317443 |
atgaagttctaggtttgtgtatgaattttatgaatttttgggtttttccttgctgttgttgatgatg |
44317509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 191 - 229
Target Start/End: Complemental strand, 13866214 - 13866176
Alignment:
Q |
191 |
tatgagtttttgggtttttccttgctgttgttgatgatg |
229 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
13866214 |
tatgaatttttgggtttttccttgctgttgttgatgatg |
13866176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 84
Target Start/End: Complemental strand, 12991672 - 12991638
Alignment:
Q |
50 |
gttttggaatttgtatggaaaagatattgggaaga |
84 |
Q |
|
|
||||||||||||||||||||||||||||| ||||| |
|
|
T |
12991672 |
gttttggaatttgtatggaaaagatattgcgaaga |
12991638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 199
Target Start/End: Original strand, 50394147 - 50394183
Alignment:
Q |
163 |
atgaagttctgggttcgtgcatgaattttatgagttt |
199 |
Q |
|
|
||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
50394147 |
atgaagttctgggtttgtgaatgaattttatgagttt |
50394183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 99; Significance: 6e-49; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 4155981 - 4155871
Alignment:
Q |
4 |
agttttaaagagatatggttctggaatttgtatggaaagagatatagttttggaatttgtatggaaaagatattgggaagaagatgggttaggttataca |
103 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
T |
4155981 |
agttttaaagagatatggttctggaatttgtatggaaagagatatagttttggaatttgtatggaaaggatattgggaagaagatgagttaggttataca |
4155882 |
T |
 |
Q |
104 |
tagaaacatga |
114 |
Q |
|
|
| ||||||||| |
|
|
T |
4155881 |
tggaaacatga |
4155871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 163 - 229
Target Start/End: Complemental strand, 4155820 - 4155754
Alignment:
Q |
163 |
atgaagttctgggttcgtgcatgaattttatgagtttttgggtttttccttgctgttgttgatgatg |
229 |
Q |
|
|
|||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4155820 |
atgaagttatgggtttgtgtatgaattttatgagtttttgggtttttccttgctgttgttgatgatg |
4155754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 163 - 209
Target Start/End: Complemental strand, 40262878 - 40262832
Alignment:
Q |
163 |
atgaagttctgggttcgtgcatgaattttatgagtttttgggttttt |
209 |
Q |
|
|
||||||||||||||| ||| ||||||||||||||||| ||||||||| |
|
|
T |
40262878 |
atgaagttctgggtttgtgtatgaattttatgagtttctgggttttt |
40262832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 226
Target Start/End: Original strand, 38676865 - 38676929
Alignment:
Q |
163 |
atgaagttctgggttcgtgcatgaattttatgagtttttgg-gtttttccttgctgttgttgatg |
226 |
Q |
|
|
||||||||||| ||| ||| ||||||||||||||||| ||| ||||| |||| ||||||||||| |
|
|
T |
38676865 |
atgaagttctgagtttgtgaatgaattttatgagtttctggatttttttcttgttgttgttgatg |
38676929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 99; Significance: 6e-49; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 6229110 - 6229000
Alignment:
Q |
4 |
agttttaaagagatatggttctggaatttgtatggaaagagatatagttttggaatttgtatggaaaagatattgggaagaagatgggttaggttataca |
103 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
T |
6229110 |
agttttaaagagatatgattctggaatttgtatggaaagagatatagttttggaatttgtatggaaaggatattgggaagaagatgagttaggttataca |
6229011 |
T |
 |
Q |
104 |
tagaaacatga |
114 |
Q |
|
|
||||||||||| |
|
|
T |
6229010 |
tagaaacatga |
6229000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 17245036 - 17244926
Alignment:
Q |
4 |
agttttaaagagatatggttctggaatttgtatggaaagagatatagttttggaatttgtatggaaaagatattgggaagaagatgggttaggttataca |
103 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
T |
17245036 |
agttttaaagagatatggttctggaatttgtatagaaagagatatagttttggaatttgtatggaaaggatattgggaagaagatgagttaggttataca |
17244937 |
T |
 |
Q |
104 |
tagaaacatga |
114 |
Q |
|
|
||||||||||| |
|
|
T |
17244936 |
tagaaacatga |
17244926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 163 - 229
Target Start/End: Complemental strand, 6228951 - 6228885
Alignment:
Q |
163 |
atgaagttctgggttcgtgcatgaattttatgagtttttgggtttttccttgctgttgttgatgatg |
229 |
Q |
|
|
||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
6228951 |
atgaagttctgggtttgtgtatgaattttatgagtttttgggttttttcttgctgttgttgatgatg |
6228885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 191 - 229
Target Start/End: Complemental strand, 17244858 - 17244820
Alignment:
Q |
191 |
tatgagtttttgggtttttccttgctgttgttgatgatg |
229 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
17244858 |
tatgagtttttggttttttccttgctgttgttgatgatg |
17244820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 99; Significance: 6e-49; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 19184978 - 19184868
Alignment:
Q |
4 |
agttttaaagagatatggttctggaatttgtatggaaagagatatagttttggaatttgtatggaaaagatattgggaagaagatgggttaggttataca |
103 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
T |
19184978 |
agttttaaagagatatggttctggaatttgtatggaaagagatatagttttggaatttgtacggaaaggatattgggaagaagatgagttaggttataca |
19184879 |
T |
 |
Q |
104 |
tagaaacatga |
114 |
Q |
|
|
||||||||||| |
|
|
T |
19184878 |
tagaaacatga |
19184868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 163 - 229
Target Start/End: Complemental strand, 19184819 - 19184753
Alignment:
Q |
163 |
atgaagttctgggttcgtgcatgaattttatgagtttttgggtttttccttgctgttgttgatgatg |
229 |
Q |
|
|
||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
19184819 |
atgaagttctgggtttgtgtatgaattttaagagtttttgggtttttccttgctgttgttgatgatg |
19184753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 163 - 209
Target Start/End: Complemental strand, 2596641 - 2596595
Alignment:
Q |
163 |
atgaagttctgggttcgtgcatgaattttatgagtttttgggttttt |
209 |
Q |
|
|
||||||||||||||| ||| ||||||||||||||||||||| ||||| |
|
|
T |
2596641 |
atgaagttctgggtttgtgtatgaattttatgagtttttggattttt |
2596595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 23991648 - 23991538
Alignment:
Q |
4 |
agttttaaagagatatggttctggaatttgtatggaaagagatatagttttggaatttgtatggaaaagatattgggaagaagatgggttaggttataca |
103 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| | ||||| ||||||| |
|
|
T |
23991648 |
agttttaaagagatatggttctggaatttgtatggaaagagatatagttttggaatttgtatggaaaggatattaggaagaaggtaagttagcttataca |
23991549 |
T |
 |
Q |
104 |
tagaaacatga |
114 |
Q |
|
|
|||||| |||| |
|
|
T |
23991548 |
tagaaaaatga |
23991538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 163 - 229
Target Start/End: Complemental strand, 23991488 - 23991422
Alignment:
Q |
163 |
atgaagttctgggttcgtgcatgaattttatgagtttttgggtttttccttgctgttgttgatgatg |
229 |
Q |
|
|
|||||||||| |||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
23991488 |
atgaagttctcggtttgtgtatgaattttatgagtttttgggttttttcttgctgttgttgatgatg |
23991422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 225
Target Start/End: Original strand, 15741420 - 15741483
Alignment:
Q |
163 |
atgaagttctgggttcgtgcatgaattttatgagtttttggg-tttttccttgctgttgttgat |
225 |
Q |
|
|
||||||||||||||| ||| ||||||||||||||||| |||| ||||| ||||||| ||||||| |
|
|
T |
15741420 |
atgaagttctgggtttgtgtatgaattttatgagtttctgggtttttttcttgctgctgttgat |
15741483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 209
Target Start/End: Complemental strand, 38961306 - 38961260
Alignment:
Q |
163 |
atgaagttctgggttcgtgcatgaattttatgagtttttgggttttt |
209 |
Q |
|
|
|||||||| |||||| ||| ||||||||||||||||| ||||||||| |
|
|
T |
38961306 |
atgaagttttgggtttgtgtatgaattttatgagtttctgggttttt |
38961260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 226
Target Start/End: Complemental strand, 43727536 - 43727472
Alignment:
Q |
163 |
atgaagttctgggttcgtgcatgaattttatgagtttttgg-gtttttccttgctgttgttgatg |
226 |
Q |
|
|
|||||||||||| || ||| ||||||||||||||||| ||| ||||| |||| ||||||||||| |
|
|
T |
43727536 |
atgaagttctggatttgtgtatgaattttatgagtttctggatttttttcttgttgttgttgatg |
43727472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University