View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0739_high_20 (Length: 252)
Name: NF0739_high_20
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0739_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 42018084 - 42018326
Alignment:
| Q |
1 |
tgctgccaagaaaacggaaactcttccattttgtcagagtcaggtgtcagtggatgagagaatgagctccgatgtcatcgagactgaagcaaagctttca |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42018084 |
tgctgccaagaaaacggaaactcttcc-ttttgtcagagtcaggtgtcagtggatgagagaatgagctccgatgtcatcgagactgaagcaaagctttca |
42018182 |
T |
|
| Q |
101 |
gctgataataataagagcagcaaggcggcggtttctcgaatcaacagcgggaaaggagcttcatgcaggtctcgttctatgacatcatggcttgacggct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42018183 |
gctgataataataagagcagcaaggcggcggtttctcgaatcaacagcgggaaaggagcttcatgcaggtctcgttctatgacatcatggcttgacggct |
42018282 |
T |
|
| Q |
201 |
gggaacaagaagatacttatgctgctcttgctgttgtctgtgct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42018283 |
gggaacaagaagatacttatgctgctcttgctgttgtctgtgct |
42018326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 1251304 - 1251546
Alignment:
| Q |
1 |
tgctgccaagaaaacggaaactcttccattttgtcagagtcaggtgtcagtggatgagagaatgagctccgatgtcatcgagactgaagcaaagctttca |
100 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251304 |
tgctgccaagaaaacggaaactattcc-ttttgtcagagtcaggtgtcagtggatgagagaatgagctccgatgtcatcgagactgaagcaaagctttca |
1251402 |
T |
|
| Q |
101 |
gctgataataataagagcagcaaggcggcggtttctcgaatcaacagcgggaaaggagcttcatgcaggtctcgttctatgacatcatggcttgacggct |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251403 |
gctgataataataagagcagcaaggcgtcggtttctcgaatcaacagcgggaaaggagcttcatgcaggtctcgttctatgacatcatggcttgacggct |
1251502 |
T |
|
| Q |
201 |
gggaacaagaagatacttatgctgctcttgctgttgtctgtgct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251503 |
gggaacaagaagatacttatgctgctcttgctgttgtctgtgct |
1251546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5352 times since January 2019
Visitors: 4850