View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0739_high_24 (Length: 249)
Name: NF0739_high_24
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0739_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 12984883 - 12985091
Alignment:
| Q |
1 |
cacatctttgggaatcgctgttctttcaataaaatgcaaagacgattttgtggcaacagctcttacttctgcccattcagagaaacaatgacaaagattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12984883 |
cacatctttgggaatcgctgttctttcaataaaatgcaaagacgattttgtggcaacagctcttacttctgcccattcagagaaacaatgacaaagattt |
12984982 |
T |
 |
| Q |
101 |
gcaaatttaaccgcagcaacacttccactagtagcgagtaaaatccgaggcttcctgggggcagcagcattgactgacatattctctccaactgaactca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12984983 |
gcaaatttaaccgcagcaacacttccactagtagcgagtaaaatccgaggcttcctgggggcagcagcattgactgacatattctctccaactgaactca |
12985082 |
T |
 |
| Q |
201 |
caggttctg |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
12985083 |
caggttctg |
12985091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 90 - 157
Target Start/End: Original strand, 22796017 - 22796084
Alignment:
| Q |
90 |
gacaaagatttgcaaatttaaccgcagcaacacttccactagtagcgagtaaaatccgaggcttcctg |
157 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
22796017 |
gacaaagatttgcaaatttaacagctgcaacacttccacgagtagcaagtaaaatccgaggcttcctg |
22796084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University