View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0739_low_18 (Length: 339)
Name: NF0739_low_18
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0739_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 27 - 287
Target Start/End: Original strand, 10219698 - 10219958
Alignment:
Q |
27 |
gttaaagattgtgatcaacatattgcttgggctactgaagcatttggtttagagcctgaagctgttaatctttggattgggaacagacattcatctactt |
126 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
T |
10219698 |
gttaaagattgtgatcaacatattgcttgggctactgaagcatttggtttagagcctgaagctgttaatctttggattggaaacaaacattcatctactt |
10219797 |
T |
 |
Q |
127 |
ggtttcataaggatcattatgagaatctttatgctgttgttactggtcaaaaacactttcttttgtttcctcctactgatgttcatcgcttttatattcg |
226 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10219798 |
ggtttcataaggatcattatgagaatctttatgctgttgttactggtcaaaaacactttcttttgtttcctcctactgatgttcatcgcttttatattcg |
10219897 |
T |
 |
Q |
227 |
gaattaccctgctgctacttataaatattacatggtatcattcattacttttcttgttcat |
287 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
10219898 |
gaattaccctgctgctacttataaatattacatggtatgattcattacttttcttgttcat |
10219958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5139 times since January 2019
Visitors: 4845