View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0739_low_26 (Length: 318)
Name: NF0739_low_26
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0739_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 98 - 240
Target Start/End: Complemental strand, 106993 - 106851
Alignment:
| Q |
98 |
ataaagatcaaaagagaagagaatgaattacttgggtcgcgagcggtggctttaacagtgtaaccacgatggagaaggtaacgaacgagccatgaagcta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
106993 |
ataaagatcaaaagagaagagaatgaattacttgggtcgcgaacggtggctttaacagtgtaaccacgatggagaaggtaacgaacgagccatgaagcta |
106894 |
T |
|
| Q |
198 |
tgtaacctgaagctccagttacacacacaacgttgctgttcat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
106893 |
tgtaacctgaagctccagttacacacacaacgttgctgttcat |
106851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 126 - 228
Target Start/End: Complemental strand, 87595 - 87493
Alignment:
| Q |
126 |
tacttgggtcgcgagcggtggctttaacagtgtaaccacgatggagaaggtaacgaacgagccatgaagctatgtaacctgaagctccagttacacacac |
225 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||| |||||||| ||||| | || |||||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
87595 |
tacttggatcgcgaacggtggctttaacagtgtagccacgatgaagaagcaatcggacgagccatgaagcgatgtaacctgaagcgccagtcacacacac |
87496 |
T |
|
| Q |
226 |
aac |
228 |
Q |
| |
|
||| |
|
|
| T |
87495 |
aac |
87493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3146 times since January 2019
Visitors: 4805