View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0739_low_30 (Length: 301)
Name: NF0739_low_30
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0739_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 29864076 - 29863852
Alignment:
| Q |
1 |
tttgtcatacctatcattaatatgaatcatgctagccttgtataatttatgtcataactgcaaagatattttagaatttagtactactgttttgtatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29864076 |
tttgtcatacctatcattaatatgaatcatgctagccttgtataatttatgtcataactgcaaagatattttagaatttagtactactgttttgtatgtt |
29863977 |
T |
|
| Q |
101 |
gaatattatattttatgcact----taatctaaccaaaagaatcttacataaatcttacctaaaggataacattacattgcaaaatacaaactggtcct- |
195 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29863976 |
gaatattatattttatgcacttaattaatctaaccaaaagaatcttacataaatcttacctaaaggataacattacattgcaaaatacaaactggtcctc |
29863877 |
T |
|
| Q |
196 |
-cacaactcccatatctccaatctg |
219 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
29863876 |
acacaattcccatatctccaatctg |
29863852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5348 times since January 2019
Visitors: 4850