View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0739_low_37 (Length: 267)
Name: NF0739_low_37
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0739_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 8e-33; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 24 - 103
Target Start/End: Complemental strand, 15427346 - 15427267
Alignment:
| Q |
24 |
tgtcgaaaaatatgtgcataattaagatgaagaataaaagtatgttataaagaaaatgaccttgttataattgggttcaa |
103 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15427346 |
tgtcaaaaaaaatgtgcataattaagatgaagaataaaagtatgttataaagaaaatgaccttgttataattgggttcaa |
15427267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 169 - 229
Target Start/End: Complemental strand, 15427201 - 15427140
Alignment:
| Q |
169 |
aaagatctgatccatggttggaagtt-agtcccagtggatttagaggtagttggtgatgatg |
229 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15427201 |
aaagatctgatccatggttggaagtttagtcccagtggatttagaggtagttggtgatgatg |
15427140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 169 - 220
Target Start/End: Complemental strand, 15436622 - 15436570
Alignment:
| Q |
169 |
aaagatctgatccatggttggaagtt-agtcccagtggatttagaggtagttg |
220 |
Q |
| |
|
||||||||| ||||||||||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
15436622 |
aaagatctgccccatggttggatgtttagtcccagttgatttagaggtagttg |
15436570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3241 times since January 2019
Visitors: 4808