View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0739_low_44 (Length: 256)
Name: NF0739_low_44
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0739_low_44 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 9 - 73
Target Start/End: Complemental strand, 33169893 - 33169829
Alignment:
| Q |
9 |
gtttaaatttgtcaaaatgtgttattctaagatgcacatgtattttattttcataagtttgatgt |
73 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
33169893 |
gtttaaacttgtcaaaatgtgttattctaagatgcacatgcaatttattttcataagtttgatgt |
33169829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 180 - 225
Target Start/End: Complemental strand, 33169754 - 33169709
Alignment:
| Q |
180 |
aatagaaatgtgagtgataagagaggtgagtacaattttcgctaaa |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33169754 |
aatagaaatgtgagtgataagagaggtgagtacaattttccctaaa |
33169709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4862 times since January 2019
Visitors: 4840