View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0739_low_44 (Length: 256)

Name: NF0739_low_44
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0739_low_44
NF0739_low_44
[»] chr7 (2 HSPs)
chr7 (9-73)||(33169829-33169893)
chr7 (180-225)||(33169709-33169754)


Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 9 - 73
Target Start/End: Complemental strand, 33169893 - 33169829
Alignment:
9 gtttaaatttgtcaaaatgtgttattctaagatgcacatgtattttattttcataagtttgatgt 73  Q
    ||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||    
33169893 gtttaaacttgtcaaaatgtgttattctaagatgcacatgcaatttattttcataagtttgatgt 33169829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 180 - 225
Target Start/End: Complemental strand, 33169754 - 33169709
Alignment:
180 aatagaaatgtgagtgataagagaggtgagtacaattttcgctaaa 225  Q
    |||||||||||||||||||||||||||||||||||||||| |||||    
33169754 aatagaaatgtgagtgataagagaggtgagtacaattttccctaaa 33169709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University