View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0739_low_52 (Length: 249)
Name: NF0739_low_52
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0739_low_52 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 125 - 249
Target Start/End: Complemental strand, 36412089 - 36411965
Alignment:
Q |
125 |
agaaactcatcctcgggaggctgaacaaactgcagcttgagccttccatcctctctataagcacgcaagacctcctgtgttggtatccttacctcttcaa |
224 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
36412089 |
agaaactcatcctcgggaggctgaacaaactgcagcttgagccttccatcctctctataagcacgcaagacctcctgtgtgggtatccttacctcttcaa |
36411990 |
T |
 |
Q |
225 |
ggacaaatcttccattattcctaat |
249 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
36411989 |
ggacaaatcttccattattcctaat |
36411965 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University