View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0739_low_58 (Length: 234)
Name: NF0739_low_58
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0739_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 16 - 150
Target Start/End: Complemental strand, 20523632 - 20523498
Alignment:
Q |
16 |
taacaaggaatagttatttaatggcacattatagcttttaaatacgacccttcctcaactcttctataacctgtaattttcttcatccctttctcttctg |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20523632 |
taacaaggaatagttatttaatggcacattatagcttttaaatacgacccttcctcaactcttctataacctgtaattttcttcatccctttctcttctg |
20523533 |
T |
 |
Q |
116 |
tgcctgttacctttgtttcgttatttctgatgatg |
150 |
Q |
|
|
|||||||||||||||||||||||||||| |||||| |
|
|
T |
20523532 |
tgcctgttacctttgtttcgttatttcttatgatg |
20523498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4174 times since January 2019
Visitors: 4829