View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0739_low_59 (Length: 232)
Name: NF0739_low_59
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0739_low_59 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 51840544 - 51840453
Alignment:
| Q |
1 |
gtttctcttcttagaatgatccttggttggaagggggtttgttacgtgatagatttagtcggattttttatttgcatgttgattctaatatt |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51840544 |
gtttctcttcttagaatgatccttggttggaagggggtttgttacgtgatagatttagtcggattttttatttgcatgttgattctaatatt |
51840453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3440 times since January 2019
Visitors: 4814