View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0739_low_60 (Length: 228)

Name: NF0739_low_60
Description: NF0739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0739_low_60
NF0739_low_60
[»] chr2 (1 HSPs)
chr2 (1-132)||(13591583-13591714)


Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 13591714 - 13591583
Alignment:
1 gtagtttagatgcataacacccatgagtgcaacttgtaccccataagataagcgcaatgagtttgaacacaagcataagcaagttgatcatcactaagac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13591714 gtagtttagatgcataacacccatgagtgcaacttgtaccccataagataagcgcaatgagtttgaacacaagcataagcaagttgatcatcactaagac 13591615  T
101 actcttcactccaattactcattctaatctct 132  Q
    ||||||||||||||||||||||||||||||||    
13591614 actcttcactccaattactcattctaatctct 13591583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University