View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_105 (Length: 259)
Name: NF0740_high_105
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_high_105 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 23143608 - 23143525
Alignment:
Q |
1 |
tagttttataaaaatttcttaataacattgataatgcataattctgaatacaaaaatatgcaagtaaaatcctctttgttagat |
84 |
Q |
|
|
||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||| |||| |||||||||||||||||| |
|
|
T |
23143608 |
tagttttataaaaatctcttaataatattgataatgcataattccgaatacaaaaatatgtaagttaaatcctctttgttagat |
23143525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 174 - 249
Target Start/End: Complemental strand, 23143464 - 23143390
Alignment:
Q |
174 |
tttagtgctgagaatattttcat-caagtttaatccttttctctgtaccatagtcaggatttattaatttatctgtg |
249 |
Q |
|
|
|||||| || ||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
23143464 |
tttagttcttagaatattttcattcaagtttaaccctt--ctctgtaccatagtcaggatttattaatttatctgtg |
23143390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University