View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_112 (Length: 251)
Name: NF0740_high_112
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_high_112 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 6643206 - 6643440
Alignment:
| Q |
13 |
aatattatgatcacaatggttatcattaccacttgactatgtttggtaaaagctttatcctacttgcttggcaagacaacaagcttgtctttgtttgagc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6643206 |
aatattatgatcacaatggttatcattaccacttgactatgtttggtaaaagctttatcctacttgcttggcaagacaacaagcttgtctttgtttgagc |
6643305 |
T |
 |
| Q |
113 |
atatctctctttctttttaaccaactacttacttgtatatagataatagataataaggtctaccatatttattatnnnnnnnnntggcacgtatccataa |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6643306 |
atatctctctttctttttaaccaac----tacttgtatatagataatagataataaggtctaccatatttatttaaaaaaaaaatggcacgtatccataa |
6643401 |
T |
 |
| Q |
213 |
ttgttgaatctaaaatccatattaaaatagcataaatta |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6643402 |
ttgttgaatctaaaatccatattaaaatagcataaatta |
6643440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University