View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_118 (Length: 250)
Name: NF0740_high_118
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_high_118 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 40582374 - 40582610
Alignment:
| Q |
1 |
cttggaatttgatgctattctatcttcattataacggtgttgtaaatttaggaatgcaatttcggtccttggatcatgattggtgattttaacaaggttc |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40582374 |
cttggaatttgatgttattctatcttcattataacggtgttgtaaatttaggaatgcaatttcggtccttggatcatgattggtgattttaacaaggttc |
40582473 |
T |
|
| Q |
101 |
gcaattgcataaaaatatctggtgggaacttcaatttgtctgaggacaatcttgtctctcagatgtttgatgcttgtggggtcgtagacttagacacaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40582474 |
gcaattgcataaaaatatctggtgggaacttcaatttgtctgaggacaatcttgtctctcagatgtttgatgcttgtggggtcgtagacttagacacaat |
40582573 |
T |
|
| Q |
201 |
tggtggcatctttagttggaggaaaagttctcaatat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40582574 |
tggtggcatctttagttggaggaaaagttctcaatat |
40582610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5249 times since January 2019
Visitors: 4847