View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_119 (Length: 247)
Name: NF0740_high_119
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_high_119 |
 |  |
|
[»] scaffold0005 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0005 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 230893 - 231042
Alignment:
Q |
1 |
cccttatcacattaaattggcttatacttttccatgcatctgtgttctacaaatgcaaggtgcttttatggcatattnnnnnnnncaacgggcattgaaa |
100 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
230893 |
cccttatcacattaaattgacttatacttttccatgcatctgtgttttaccaatgcaaggtgcttttatggcatattacaaaaaacaacgggcattgaaa |
230992 |
T |
 |
Q |
101 |
ccctcggacttcaaatcacatttggcttggattgcttcaattgaagatca |
150 |
Q |
|
|
||||| ||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
T |
230993 |
ccctcagacttcaaatcacatttggcttggattccttcaattgaatatca |
231042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 14586481 - 14586332
Alignment:
Q |
1 |
cccttatcacattaaattggcttatacttttccatgcatctgtgttctacaaatgcaaggtgcttttatggcatattnnnnnnnncaacgggcattgaaa |
100 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
14586481 |
cccttatcacattaaattgacttatacttttccatgcatctgtgttttaccaatgcaaggtgcttttatggcatattacaaaaaacaacgggcattgaaa |
14586382 |
T |
 |
Q |
101 |
ccctcggacttcaaatcacatttggcttggattgcttcaattgaagatca |
150 |
Q |
|
|
||||| ||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
T |
14586381 |
ccctcagacttcaaatcacatttggcttggattccttcaattgaatatca |
14586332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 3650106 - 3650181
Alignment:
Q |
1 |
cccttatcacattaaattggcttatacttttccatgcatctgtgttctacaaatgcaaggtgcttttatggcatat |
76 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||| |||||| ||| ||||||||||||||| ||||||||| |
|
|
T |
3650106 |
cccttatcacattaaattggcttatactttcccatgcatatgtgttgtaccaatgcaaggtgctttcatggcatat |
3650181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 33053980 - 33053905
Alignment:
Q |
1 |
cccttatcacattaaattggcttatacttttccatgcatctgtgttctacaaatgcaaggtgcttttatggcatat |
76 |
Q |
|
|
|||||||||||||||||||||||||||||| |||| ||| |||||| ||| ||||||||||||||||||||||||| |
|
|
T |
33053980 |
cccttatcacattaaattggcttatactttcccatacatatgtgttgtaccaatgcaaggtgcttttatggcatat |
33053905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4492 times since January 2019
Visitors: 4835