View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_127 (Length: 227)
Name: NF0740_high_127
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_high_127 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 6 - 75
Target Start/End: Original strand, 46537982 - 46538051
Alignment:
| Q |
6 |
agatatttgggtgtgattatcgagaaaaaacaaacacaccctctatattgttgtacatactagtagatca |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46537982 |
agatatttgggtgtgattatcgagaaaaaacacacacaccctctatattgttgtacatactagtagatca |
46538051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 128 - 227
Target Start/End: Original strand, 46538104 - 46538196
Alignment:
| Q |
128 |
aaacaatgacaaaataccatgttaaggttgtaacttgtaatttgtaattatatgaattatttggttacagttacagatatcagagaaccagcttgttatt |
227 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46538104 |
aaacaatgacaaaatactatgttaaggttgtaacttgt-------aattatatgaattatttggttacagttacagatatcagagaacaagcttgttatt |
46538196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University