View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_132 (Length: 213)
Name: NF0740_high_132
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_high_132 |
 |  |
|
| [»] scaffold0074 (1 HSPs) |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0074 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: scaffold0074
Description:
Target: scaffold0074; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 110 - 213
Target Start/End: Complemental strand, 19517 - 19416
Alignment:
| Q |
110 |
aacctgtgcatcatgacatcatagaagcaaccatttatctaaagagatgatagnnnnnnnntcccttttttacgaggcttctctagtagttagttattag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19517 |
aacctgtgcatcatgacatcatagaagcaaccatttatctaaagagatgatag--caaaaatcacttttttatgaggcttctctagtagttagttattag |
19420 |
T |
 |
| Q |
210 |
tcac |
213 |
Q |
| |
|
|||| |
|
|
| T |
19419 |
tcac |
19416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 110 - 213
Target Start/End: Complemental strand, 8696788 - 8696687
Alignment:
| Q |
110 |
aacctgtgcatcatgacatcatagaagcaaccatttatctaaagagatgatagnnnnnnnntcccttttttacgaggcttctctagtagttagttattag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8696788 |
aacctgtgcatcatgacatcatagaagcaaccatttatctaaagagatgatag--caaaaatcacttttttatgaggcttctctagtagttagttattag |
8696691 |
T |
 |
| Q |
210 |
tcac |
213 |
Q |
| |
|
|||| |
|
|
| T |
8696690 |
tcac |
8696687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University