View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_18 (Length: 468)
Name: NF0740_high_18
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_high_18 |
 |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 41 - 372
Target Start/End: Original strand, 20050549 - 20050882
Alignment:
| Q |
41 |
ttttttatcactcaaactcccctttttattatatatta--taaataaaaagcttcactcttttttcctttaacaaattaacacaaataatcctagtatcc |
138 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20050549 |
ttttttataactcaaactcccctttttattatattataaataaataaaaagcttcactcttttttcctttaataaattaacacaaataatcctagtatcc |
20050648 |
T |
 |
| Q |
139 |
aaccaataacacaaataatcctagtatcctactttagcacacatcaaatcttgttttctttgtttcggtactgtgttgttgtgtctcaaaggcaaatata |
238 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20050649 |
aaccaataacacaattaatcctagtatcctactttagcacacatcaaatcttgttttctttgtttcggtactgtgttgttgtgtctgaaaggcaaatata |
20050748 |
T |
 |
| Q |
239 |
tggtaaacgatgtcaggttcgaaattggtgaattatattatcttgtgttcatttctggctttgaatttctttcttcaagagtttggatccaaagctcaac |
338 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20050749 |
tggtatacgatgtcaggttcgaaattggtgaattatattatcttgtgttcatttctggctttgaatttctttcttcaagagtttggatccaaagctcaac |
20050848 |
T |
 |
| Q |
339 |
tcataccacaagatgaaggtacacttaatttcac |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20050849 |
tcataccacaagatgaaggtacacttaatttcac |
20050882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 11 - 46
Target Start/End: Original strand, 3118954 - 3118989
Alignment:
| Q |
11 |
catagggggtgaaaagtgcagtttagcctatttttt |
46 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3118954 |
catagggggcgaaaagtgcagtttagcctatttttt |
3118989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 11 - 43
Target Start/End: Complemental strand, 5677 - 5645
Alignment:
| Q |
11 |
catagggggtgaaaagtgcagtttagcctattt |
43 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
5677 |
catagggggcgaaaagtgcagtttagcctattt |
5645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 11 - 47
Target Start/End: Complemental strand, 23765447 - 23765411
Alignment:
| Q |
11 |
catagggggtgaaaagtgcagtttagcctatttttta |
47 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
23765447 |
catagggggcgaaaagtgcagtttagcctacttttta |
23765411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 11 - 47
Target Start/End: Complemental strand, 23815295 - 23815259
Alignment:
| Q |
11 |
catagggggtgaaaagtgcagtttagcctatttttta |
47 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
23815295 |
catagggggcgaaaagtgcagtttagcctacttttta |
23815259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University