View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_32 (Length: 411)
Name: NF0740_high_32
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_high_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 98 - 385
Target Start/End: Original strand, 33298839 - 33299127
Alignment:
Q |
98 |
agtgtgtatgtttgtaagtgcaaaactaattgatgatataatatttaacattttgcagtggaactgggaaactatattaatcggagcaagctttttgagt |
197 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
33298839 |
agtgtgtatgtttgtaagtgcaaaactgattgatgatataatatttaacattttgcagtggaactgggaaactatattaatcggagctagctttttgagt |
33298938 |
T |
 |
Q |
198 |
ttccttctggtcgccaaatttattgtatgacattaaactccctacttcatcttactattatatctt-aaatatttaggactgtaaaagttttttctaatt |
296 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||| |||||||||||||| |||||||||||||||||| |
|
|
T |
33298939 |
ttccttctggtcgccaaatttattgtatgacattaaactccctatttcatcttactattgtttcttaaaatatttaggactataaaagttttttctaatt |
33299038 |
T |
 |
Q |
297 |
atttcatgttgtgttgcttagggaaagaagaacaagaaattcttctgggtgccagcaattgccccattgatatcagttgtgttgtccac |
385 |
Q |
|
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33299039 |
atttcatgctgtgttgattagggaaagaagaacaagaaattcttctgggtgccagcaattgccccattgatatcagttgtgttgtccac |
33299127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 316 - 376
Target Start/End: Original strand, 25720142 - 25720202
Alignment:
Q |
316 |
agggaaagaagaacaagaaattcttctgggtgccagcaattgccccattgatatcagttgt |
376 |
Q |
|
|
||||||||||| | | |||||||||||||| ||||||||||| ||||||||||| ||||| |
|
|
T |
25720142 |
agggaaagaagggccaaaaattcttctgggttccagcaattgctccattgatatctgttgt |
25720202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3357 times since January 2019
Visitors: 4812