View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_45 (Length: 382)
Name: NF0740_high_45
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_high_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 40 - 380
Target Start/End: Original strand, 34232374 - 34232714
Alignment:
Q |
40 |
atatatacacacaaatcttcaattatatttcattcttcatcattcattataattcataacccttaannnnnnnnnnnnnnnnnnnnacaatatttctttc |
139 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
34232374 |
atatatacacacaaatcttcaattatatttcattcttcatcattcattataattcataacccttaatctctcttatcttctcttctacaatatttctttc |
34232473 |
T |
 |
Q |
140 |
cctatggcttcacaaaatactcaagttcaatttcaagactcattacccttcatggcaaacaagcttggtggggatggattaatagatgaattatgcaatg |
239 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
34232474 |
cctatggcttcacaaaatactcaagttcaatttcaagactcattacccttgatggcaaacaagcttggtggtgatggattaatagatgaattatgcaatg |
34232573 |
T |
 |
Q |
240 |
gtttcaatcttttgatggatacaaataaaggtgtcattacttttgaaagccttaagaagaattcagctttgcttgggttacaagatttgaccgatgtgga |
339 |
Q |
|
|
|||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34232574 |
gtttcaatcttttgatggattctactaaaggtgtcattacttttgaaagccttaagaagaattcagctttgcttgggttacaagatttgaccgatgtgga |
34232673 |
T |
 |
Q |
340 |
acttcaatccatgattgttgaaggtgattttgttggagatg |
380 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||| |
|
|
T |
34232674 |
acttcaatccatgattgttgaaggtgattttgatggtgatg |
34232714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 188 - 319
Target Start/End: Original strand, 23630506 - 23630637
Alignment:
Q |
188 |
ttcatggcaaacaagcttggtggggatggattaatagatgaattatgcaatggtttcaatcttttgatggatacaaataaaggtgtcattacttttgaaa |
287 |
Q |
|
|
||||||||||||||| | ||||| ||||| || ||||||||| |||| || || ||||||||||||| |||| | ||||||||||||||||||||||||| |
|
|
T |
23630506 |
ttcatggcaaacaagttaggtggagatggcttgatagatgaactatgtaacgggttcaatcttttgaaggattctaataaaggtgtcattacttttgaaa |
23630605 |
T |
 |
Q |
288 |
gccttaagaagaattcagctttgcttgggtta |
319 |
Q |
|
|
|||| || | ||||||||||||||| |||||| |
|
|
T |
23630606 |
gcctaaaaatgaattcagctttgctagggtta |
23630637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5720 times since January 2019
Visitors: 4858