View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_50 (Length: 368)
Name: NF0740_high_50
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_high_50 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 99 - 346
Target Start/End: Original strand, 3640080 - 3640327
Alignment:
| Q |
99 |
tgtggtactgttggaagagcaaaagatggaaactaagctgctctcctcttatgcataagtccatgtaggggctcgaaccccgaacaccccaaaggtgaat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
3640080 |
tgtggtactgttggaagagcaaaagatggaaactaagctgctctcctcttatgcataagtccatgtaggggctcgaaccctgaacactccaaaggtgaat |
3640179 |
T |
|
| Q |
199 |
ttctagtcagtaggttcagccacacctgtcacaccctcctctgcaactgagcgtaagccagccagaacaaaggctagagcgcgtgcttcaagaccatgat |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3640180 |
ttctagtcagtaggttcagccacacctgtcataccctcctctgcaactgagcgtaagccagccagaacaaaggctagagcgcgtgcttgaagaccatgat |
3640279 |
T |
|
| Q |
299 |
ggacagaccgtcatgagccatgacgcccgtcatggtgcccagtctgtg |
346 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3640280 |
ggacagaccgtcatgagccgtgacgcccgtcatggtgcccagtctgtg |
3640327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 303 - 343
Target Start/End: Original strand, 41153936 - 41153976
Alignment:
| Q |
303 |
agaccgtcatgagccatgacgcccgtcatggtgcccagtct |
343 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
41153936 |
agaccgtcatcatccatgacgcccgtcatggtgcccagtct |
41153976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3976 times since January 2019
Visitors: 4825