View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_58 (Length: 355)
Name: NF0740_high_58
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_high_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 61 - 333
Target Start/End: Complemental strand, 14582558 - 14582286
Alignment:
Q |
61 |
actcagaaaaaagcataatccctttgtgatatgagaagccaaaagctaaagcacaaagcaaactgtttaggaaaatggagggagagtgtgtagggttttt |
160 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14582558 |
actcagaaaaaagcataatccctttgtgatatgagaagccaaaagctaaagcacaaagcaaactgtttaggaaaatggagggagagtgtgtagggttttt |
14582459 |
T |
 |
Q |
161 |
gtttaataccctctcacacttctctccatgtttgttttaagaaccatggattgatttttgccaacaaagaagcttcatccttattacaaacaagattcaa |
260 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14582458 |
gtttaataccctctcacacttctctccatgtttgttttaagaaccatggattgatttttgccaacaaagaagcttcatccttattacaaacaagattcaa |
14582359 |
T |
 |
Q |
261 |
gtcttgatggattggtttagaggatgcttaaagggctccacatagaaaggtagtggggaagttggtgtctctg |
333 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14582358 |
gtcttgatggattggtttagaggatgcttaaagggctccacatagaaaggtagtggggaagttggtgtctctg |
14582286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University