View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_68 (Length: 334)
Name: NF0740_high_68
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_high_68 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 1 - 325
Target Start/End: Original strand, 28979973 - 28980298
Alignment:
| Q |
1 |
aagataagccatttcaatatggaattattccggctacttcatgtctatgttccagtgggcttggtaatgaagatagtttgatcatctgttcgtggattgc |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
28979973 |
aagataagccaattcaatatggaattattctggctacttcaggtctatgttccagtgggcttggtaatgaagatagtttgatcatctgttcaagggttgc |
28980072 |
T |
|
| Q |
101 |
cc-ttttttgttaatattttggtgtgaatttgacattggattggtattcttaagtggacaggttccatgtttgtgatcactttactcaatttacaaactt |
199 |
Q |
| |
|
|| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28980073 |
ccattttttgttaatattttggtgcgaattcgacattggattggtattcttaagtggacaggtttcatgtttgtgatcactttactcaatttacaaactt |
28980172 |
T |
|
| Q |
200 |
agcaagcaattttagaaaaatatcgtcctcgcttcatttggtttggatgacacctttttggattctttagaaggaaaataactatccgtatttttagaca |
299 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28980173 |
agcaagcaattttagaaaaatcttgtcctcgcttcatttggtttggatgacacctttttgagttctttggaaggaaaataactatccgtatttttagaca |
28980272 |
T |
|
| Q |
300 |
aaaagaacagtcattgcaacagctag |
325 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
28980273 |
aaaagaacagtcattacaacagctag |
28980298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3725 times since January 2019
Visitors: 4818