View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_73 (Length: 326)
Name: NF0740_high_73
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_high_73 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 92 - 297
Target Start/End: Original strand, 2118440 - 2118645
Alignment:
| Q |
92 |
atcaatggtgaaaaataaatttcatgccaaatcctagatggatccatacaaccaataggtaactgtctccacatcacgaataacccgacaaagggaaaag |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2118440 |
atcaatggtgaaaaataaatttcatgccaaatcctagatggatccttacaaccaataggtaactgtctccacatcacgaataacccgacaaagggaatag |
2118539 |
T |
|
| Q |
192 |
cttaagtcgaatatgtgccttctctaacagaattttccacgaaaaagaaacaaccttagtcggagctgaactcatccacacctttgaaagattttggagt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2118540 |
cttaagtcgaatatgtgccttctctaacagaattttccacgaaaaagaaacaaccttagtcggagctgaactcatccacacctttgaaagattttggagt |
2118639 |
T |
|
| Q |
292 |
tgttgc |
297 |
Q |
| |
|
|||||| |
|
|
| T |
2118640 |
tgttgc |
2118645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 20 - 95
Target Start/End: Original strand, 2118440 - 2118515
Alignment:
| Q |
20 |
atcaatggtgaaaaataaatttcatgccaaatcctagatggatccatacaaccaataggtaactgtctccacatca |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2118440 |
atcaatggtgaaaaataaatttcatgccaaatcctagatggatccttacaaccaataggtaactgtctccacatca |
2118515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3174 times since January 2019
Visitors: 4805