View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_90 (Length: 286)
Name: NF0740_high_90
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_high_90 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 39 - 236
Target Start/End: Original strand, 31385265 - 31385459
Alignment:
| Q |
39 |
ttatctgcccaattttcgatgatcatttcaccttagtttcaaaacgtcatagaggaacgtttcaattcgaagtatccctggttcacaaacacaagcttta |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31385265 |
ttatctgcccaattttcgatgatcatttcactttagtttcgaaacgtcatggaggaacgtttcaattcgaagtat-cctggttcacaaacacaagcttta |
31385363 |
T |
 |
| Q |
139 |
tcgctactacagacccaattaacgttaactatacatcgccaacaagaattaatttcagtaactactggagggagtctagcttccaagaattgttttat |
236 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31385364 |
tcgctactacagacccaatcaacgttaac--tacatcgccaacaagaattaatttcggtaactactggagggagtctagcttccaagaattgttttat |
31385459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 66 - 167
Target Start/End: Complemental strand, 31376676 - 31376576
Alignment:
| Q |
66 |
tcaccttagtttcaaaacgtcatagaggaacgtttcaattcgaagtatccctggttcacaaacacaagctttatcgctactacagacccaattaacgtta |
165 |
Q |
| |
|
|||||||||||| ||| ||||| ||||| ||||| ||| |||| | ||||||||||||||||||||||||||||| ||| | || ||||||||||||| |
|
|
| T |
31376676 |
tcaccttagttttgaaaggtcatgaaggaatgtttcgatttgaagga-ccctggttcacaaacacaagctttatcgccactgctgatccaattaacgtta |
31376578 |
T |
 |
| Q |
166 |
ac |
167 |
Q |
| |
|
|| |
|
|
| T |
31376577 |
ac |
31376576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 7e-21; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 52 - 167
Target Start/End: Original strand, 30367105 - 30367219
Alignment:
| Q |
52 |
tttcgatgatcatttcaccttagtttcaaaacgtcatagaggaacgtttcaattcgaagtatccctggttcacaaacacaagctttatcgctactacaga |
151 |
Q |
| |
|
|||| |||| |||||||||||||||| ||| ||||| |||||||||||| ||| |||| | ||||| ||||||||||||||||||||||||||| | || |
|
|
| T |
30367105 |
tttcaatgaccatttcaccttagttttgaaatgtcatggaggaacgtttcgatttgaagga-ccctgattcacaaacacaagctttatcgctactgctga |
30367203 |
T |
 |
| Q |
152 |
cccaattaacgttaac |
167 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
30367204 |
tccaatgaacgttaac |
30367219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 68 - 141
Target Start/End: Complemental strand, 13102161 - 13102089
Alignment:
| Q |
68 |
accttagtttcaaaacgtcatagaggaacgtttcaattcgaagtatccctggttcacaaacacaagctttatcg |
141 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||| ||| |||| | |||||||||||||||| ||||||||| |
|
|
| T |
13102161 |
accttagttttaaaacatcatggaggaacgtttcgatttgaagga-gcctggttcacaaacactggctttatcg |
13102089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 114 - 143
Target Start/End: Complemental strand, 13130959 - 13130930
Alignment:
| Q |
114 |
ccctggttcacaaacacaagctttatcgct |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13130959 |
ccctggttcacaaacacaagctttatcgct |
13130930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University