View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_92 (Length: 285)
Name: NF0740_high_92
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_high_92 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 101 - 272
Target Start/End: Complemental strand, 37111000 - 37110829
Alignment:
Q |
101 |
tatgtaattttcatttcattacaaacagaagagaagatagaagctgcaagtaggagtaactgtgtaatgtcaccataatcaaaaggaacatgcttggttc |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
37111000 |
tatgtaattttcatttcattacaaacagaagagaagatagaagctgcaagtagtagtaactgtgtaatgtcaccataataaaaaggaacatgcttggttc |
37110901 |
T |
 |
Q |
201 |
atatccaataccatgtcttgattattgttgtatcatccacctgccaagttggcacgtatagttgttatattc |
272 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37110900 |
gtatccaatgccatgtcttgattattgttgtatcatccacctgccaagttggcacgtatagttgttatattc |
37110829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 28 - 98
Target Start/End: Complemental strand, 37111357 - 37111287
Alignment:
Q |
28 |
catttaccacttgtcaacttggagtgtgtctgttcatttctattctaaataaataaatgcatgtttttaaa |
98 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37111357 |
catttaccacttgtcaacttggagtgtgtctgttcatttctattctaaataaataaatgcatgtttttaaa |
37111287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University