View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_95 (Length: 275)
Name: NF0740_high_95
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_high_95 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 37409199 - 37409291
Alignment:
Q |
1 |
aaagtttgtttctcgtgagtaacggtgtgagattttaatggtggaagtggaaaattatgagtgttagtgtaaaatcaactaactgtatagctg |
93 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
37409199 |
aaagtttgtttctcgtgagtaacggtgtgaggttttaatggtggaagtggaaaattatgagtggtagtgtaaaatcaactaactgtatagctg |
37409291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6029 times since January 2019
Visitors: 4868