View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0740_high_95 (Length: 275)

Name: NF0740_high_95
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0740_high_95
NF0740_high_95
[»] chr7 (1 HSPs)
chr7 (1-93)||(37409199-37409291)


Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 37409199 - 37409291
Alignment:
1 aaagtttgtttctcgtgagtaacggtgtgagattttaatggtggaagtggaaaattatgagtgttagtgtaaaatcaactaactgtatagctg 93  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
37409199 aaagtttgtttctcgtgagtaacggtgtgaggttttaatggtggaagtggaaaattatgagtggtagtgtaaaatcaactaactgtatagctg 37409291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6029 times since January 2019
Visitors: 4868