View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_97 (Length: 272)
Name: NF0740_high_97
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_high_97 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 63 - 261
Target Start/End: Complemental strand, 42639381 - 42639183
Alignment:
| Q |
63 |
caatttcccaatgggtggtgtcgttgaatatgaagaatcagccactcaaccaccggaaaccacaaaaacttcatcacttgtccgatacaattcgcctctt |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42639381 |
caatttcccaatgggtggtgtcgttgaatatgaagaatcagccactcaaccaccgaaaaccacaaaaacttcatcacttgtccgatacaattcgcctctt |
42639282 |
T |
|
| Q |
163 |
tcacaaatcatccttattggattggtttgtttttgttgtccaggcatgttcaatgctctttcaggaatgggtggtggtggtcaagtcaatgcaacagct |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42639281 |
tcacaaatcatccttattggattggtttgtttttgttgtccaggcatgttcaatgctctttcaggaatgggtggtggtggtcaagtcaatgcaacagct |
42639183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 87 - 261
Target Start/End: Complemental strand, 42632216 - 42632039
Alignment:
| Q |
87 |
tgaatatgaagaatcagccactcaaccaccggaaaccacaaaaacttcatcac---ttgtccgatacaattcgcctctttcacaaatcatccttattgga |
183 |
Q |
| |
|
|||| ||| |||||||| |||||| |||| ||||| |||||||||||||||| || || |||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
42632216 |
tgaaaatgtagaatcaggaactcaaacaccagaaacaacaaaaacttcatcacaccttttcagatacaattcacctctttcacaaataatccttattggc |
42632117 |
T |
|
| Q |
184 |
ttggtttgtttttgttgtccaggcatgttcaatgctctttcaggaatgggtggtggtggtcaagtcaatgcaacagct |
261 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42632116 |
ttagtttgtttttgttgtccaggcatgttcaacgctctttcaggaatgggtggtggtggtcaagtcaatgcaacagct |
42632039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3306 times since January 2019
Visitors: 4812