View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_high_99 (Length: 267)
Name: NF0740_high_99
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_high_99 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 23143595 - 23143835
Alignment:
| Q |
1 |
tttttataaaactaaacattaagagaatccatatcaaattatcctactaataattgcga---atggaacatacatcgatggacatgcgatgttatccgaa |
97 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||||| | ||| ||||||||||||| ||||| ||||||||||||||| || |
|
|
| T |
23143595 |
tttttataaaactaaaaattaagagaatccatattaaattatcctactaataggtacgaaatatggaacatacatggatgggcatgcgatgttatccaaa |
23143694 |
T |
|
| Q |
98 |
ttgcagttctcccattcttcgacatctttagcccatactttctgtttgcaggagaaaatatggaagaaaagtatgaaactttgaaagtacaatttcttgc |
197 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23143695 |
ctgcagttctcccattcttcgacttctttagcccatactttctgtttgcaggagaaaatatggaagaaaaatatgaaactttgaaagtacaatttcttgt |
23143794 |
T |
|
| Q |
198 |
aatggtaataaccaataatgaatattttgatgcatagtaat |
238 |
Q |
| |
|
|||||| |||||| || ||||||||| |||||||||||||| |
|
|
| T |
23143795 |
aatggtgataaccgatgatgaatattgtgatgcatagtaat |
23143835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5233 times since January 2019
Visitors: 4847