View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_101 (Length: 314)
Name: NF0740_low_101
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_low_101 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 54012459 - 54012743
Alignment:
Q |
1 |
tcgcggtacaacccaggtttggtggagtctacctcggaggtaatagaaactaagtaaaaatgttttggaccaaagccacattgccatcacaactaaaaag |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54012459 |
tcgcggtacaacccaggtttggtggagtctacctcggaggtaatagaaactaagtaaaaatgttttggaccaaagccacattgccatcacaactaaaaag |
54012558 |
T |
 |
Q |
101 |
gttaccggcaaacatgggatgaagaagagtcttgtagtgtatgcaaatgaagaagcggagcacagaacaaacggaacatgcatgcaggatgagatatcaa |
200 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
T |
54012559 |
gttactggcaaacatgggatgaagaagagtcttgtagtgtatgcaaatgaagaagcggatcgcagaacaaacggaacatgcatgcaggatgagatatcaa |
54012658 |
T |
 |
Q |
201 |
ccatatgagccaagaaaacaaaatgtggtaccgtagtgccatttcctgcattgataaagattcaatacaactttattatcataat |
285 |
Q |
|
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54012659 |
ccatatgagccaagaaaacaaagcgtggtaccgtagcgccatttcctgcattgataaagattcaatacaactttattatcataat |
54012743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4467 times since January 2019
Visitors: 4835