View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_106 (Length: 308)
Name: NF0740_low_106
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_low_106 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 87 - 236
Target Start/End: Original strand, 19756171 - 19756320
Alignment:
Q |
87 |
gtatgtgttgaatccttgccaatatgatcaacactaacgattgtatagcatttatgatgtatgtgtggtgtataagagaatttattaccttttgatgttt |
186 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
T |
19756171 |
gtatgtgttgaattcttgccaatatgatcaacactaaggattgtatagcatttatgatgtatgtgtggtgtataagagaacttattaccttttgatcttt |
19756270 |
T |
 |
Q |
187 |
caataaggaaggatgtccaatttcaataaccctctttaaagggcgttcat |
236 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19756271 |
caataaggaaggatgtccaatttcaataaccctctttaaagggcgttcat |
19756320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 87 - 236
Target Start/End: Original strand, 24133934 - 24134083
Alignment:
Q |
87 |
gtatgtgttgaatccttgccaatatgatcaacactaacgattgtatagcatttatgatgtatgtgtggtgtataagagaatttattaccttttgatgttt |
186 |
Q |
|
|
|||||||||||||||||||||||| |||||||| | || || |||| |||| ||||||| ||||| |||| ||||||| ||| ||||||||||| || |
|
|
T |
24133934 |
gtatgtgttgaatccttgccaataggatcaacattgacaatcttataacattgatgatgtttgtgtagtgttcaagagaagttaataccttttgattatt |
24134033 |
T |
 |
Q |
187 |
caataaggaaggatgtccaatttcaataaccctctttaaagggcgttcat |
236 |
Q |
|
|
|||| |||||| |||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
24134034 |
caatgaggaagaatgtccaatttcaataactctctttatagggcgttcat |
24134083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3232 times since January 2019
Visitors: 4808