View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_107 (Length: 306)
Name: NF0740_low_107
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_low_107 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0018 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 10 - 277
Target Start/End: Original strand, 147842 - 148111
Alignment:
| Q |
10 |
gcacagaaacgtactcggcgcttgcccgggtgcacaatattgttgcctagcgctcagctccatgccccagtgtgagttagtgtcgacatacatagagtca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
147842 |
gcacagaaacgtactcggcgcttgcccgggcgcacaatattgttgcctagcgctcagctccatgccccagtgtgaggtagtgtcgacatacatagagtca |
147941 |
T |
|
| Q |
110 |
gcgccataacttccttctccagctctccagcgccatgtttttattatttccttatggttttaggtcttccaacaagtctaaaatgattcaattattttga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
147942 |
gcgccataacttccttctccagctctccagcgccatgtttttattatttccttatggttttaggtcttccaacaagtctaaaatgattcaattattttga |
148041 |
T |
|
| Q |
210 |
aaatcacacccaaaatattctctatttttaaggtcc--atgaatcatgataatgtttagacagtcagtat |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
148042 |
aaatcacacccaaaatattctctatttttaaggtccatatgaatcatgataatgtttagacagtcagtat |
148111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4179 times since January 2019
Visitors: 4829