View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_125 (Length: 276)
Name: NF0740_low_125
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_low_125 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 1841301 - 1841558
Alignment:
Q |
1 |
cctgtcttcgttttctctctgccattatatgatcaatacactgtgaactgcttctacctctcttcactctattttgttgatttattttcatttcactctt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
1841301 |
cctgtcttcgttttctctctgccattatatgatcaatacactgtgaactgcttctacctctcttcactccattttgttgatttattttcatttcactctt |
1841400 |
T |
 |
Q |
101 |
ttgattactttcatggctacgtttattattcttataattaggtgtagctggtatcatagttgaattatcaaaagacaaaatatatgtctttggagaagaa |
200 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1841401 |
ttgattactttcatggctacgtttat---tcttataattaggtgtagctggtatcatagttgaattatcaaaagacaaaatatatgtctttggagaagaa |
1841497 |
T |
 |
Q |
201 |
cttctccgaggaacctttttcgatttcaaaccttgttcttgttcttgttcttgtggttgat |
261 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
1841498 |
cttctccgaggaacctttttcgatttcaaaccatgttcttgttcttgttcttgtggttgat |
1841558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 11 - 261
Target Start/End: Original strand, 1823990 - 1824258
Alignment:
Q |
11 |
ttttctctctgccattatatgatcaatacactgtgaactgcttctacctctcttcactctatt---ttgttgatttattttcatttcactcttttgatta |
107 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||| ||||||||| |||||| |||| |||||| || |
|
|
T |
1823990 |
ttttctctctgccattatatgatcaatacattgtgaactgcttctacctttcttcactccattgatttgttgattagttttcacttcagctttttgagta |
1824089 |
T |
 |
Q |
108 |
ctttcatggctacgtttattatt----cttataatta------------ggtgtagctggtatcatagttgaattatcaaaagacaaaatatatgtcttt |
191 |
Q |
|
|
|||||| ||||||||||||| | || | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1824090 |
ctttcacggctacgtttattcctagaactca-aattaacacaaggttctggtgtagctggtatcatagttgaattatcaaaagacaaaatatatgtcttt |
1824188 |
T |
 |
Q |
192 |
ggagaagaacttctccgaggaacctttttcgatttcaaaccttgttcttgttcttgttcttgtggttgat |
261 |
Q |
|
|
|||||||||||| | |||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
T |
1824189 |
ggagaagaacttttacgaggaacctttttcgatttcaaaccatgttgttgttcttgttcttgtggttgat |
1824258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University