View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0740_low_127 (Length: 275)

Name: NF0740_low_127
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0740_low_127
NF0740_low_127
[»] chr7 (1 HSPs)
chr7 (1-115)||(37409109-37409223)


Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 37409223 - 37409109
Alignment:
1 ccgttactcacgagaaacaaactttccgttactataaaactcatcaaaacgttcttcttccattcttctccatttcccaatgaagatttctacattttct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
37409223 ccgttactcacgagaaacaaactttccgttactataaaactcatcaaaacgttcttcttccattcttctccatttcccaatgaagatttccacattttct 37409124  T
101 atcattcttctctgt 115  Q
    |||||||||||||||    
37409123 atcattcttctctgt 37409109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4816 times since January 2019
Visitors: 4839