View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_127 (Length: 275)
Name: NF0740_low_127
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_low_127 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 37409223 - 37409109
Alignment:
| Q |
1 |
ccgttactcacgagaaacaaactttccgttactataaaactcatcaaaacgttcttcttccattcttctccatttcccaatgaagatttctacattttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37409223 |
ccgttactcacgagaaacaaactttccgttactataaaactcatcaaaacgttcttcttccattcttctccatttcccaatgaagatttccacattttct |
37409124 |
T |
|
| Q |
101 |
atcattcttctctgt |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37409123 |
atcattcttctctgt |
37409109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4816 times since January 2019
Visitors: 4839