View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_128 (Length: 273)
Name: NF0740_low_128
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_low_128 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 37409250 - 37408986
Alignment:
| Q |
1 |
ttccacttccaccattaaaatctcacaccgttactcacgagaaacaaactttccgttactataaaactcatcaaaacgttcttcttccattcttctccat |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37409250 |
ttccacttccaccattaaaacctcacaccgttactcacgagaaacaaactttccgttactataaaactcatcaaaacgttcttcttccattcttctccat |
37409151 |
T |
|
| Q |
101 |
ttcccaatgaagatttctacattttctatcattcttctctgtttctttcaatccacacgagccatcttagatcctattgatttcttagcacttcaatcta |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37409150 |
ttcccaatgaagatttccacattttctatcattcttctctgtttctttcaatctacacgagccatcttagatcctattgatttcttagcacttcaatcta |
37409051 |
T |
|
| Q |
201 |
ttcgaagatcgcttcacgatgttcctggttccaaattcttctcatcatgggacttcacctatgat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37409050 |
ttcgaagatcgcttcacgatgttcctggttccaaattcttctcatcatgggacttcaccgatgat |
37408986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2972 times since January 2019
Visitors: 4805