View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0740_low_131 (Length: 267)

Name: NF0740_low_131
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0740_low_131
NF0740_low_131
[»] chr5 (1 HSPs)
chr5 (1-238)||(23143595-23143835)


Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 23143595 - 23143835
Alignment:
1 tttttataaaactaaacattaagagaatccatatcaaattatcctactaataattgcga---atggaacatacatcgatggacatgcgatgttatccgaa 97  Q
    |||||||||||||||| ||||||||||||||||| |||||||||||||||||  | |||   ||||||||||||| ||||| ||||||||||||||| ||    
23143595 tttttataaaactaaaaattaagagaatccatattaaattatcctactaataggtacgaaatatggaacatacatggatgggcatgcgatgttatccaaa 23143694  T
98 ttgcagttctcccattcttcgacatctttagcccatactttctgtttgcaggagaaaatatggaagaaaagtatgaaactttgaaagtacaatttcttgc 197  Q
     |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||     
23143695 ctgcagttctcccattcttcgacttctttagcccatactttctgtttgcaggagaaaatatggaagaaaaatatgaaactttgaaagtacaatttcttgt 23143794  T
198 aatggtaataaccaataatgaatattttgatgcatagtaat 238  Q
    |||||| |||||| || ||||||||| ||||||||||||||    
23143795 aatggtgataaccgatgatgaatattgtgatgcatagtaat 23143835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3221 times since January 2019
Visitors: 4808