View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_133 (Length: 264)
Name: NF0740_low_133
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_low_133 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 43 - 243
Target Start/End: Complemental strand, 5522268 - 5522068
Alignment:
Q |
43 |
atagattaagtctaaagctaaggatttttcttatgcatattatcaaaggatcattcaaccagtcggatgtttataaatggttttaattgctagttgatta |
142 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
5522268 |
atagattaagtctaaagctaaggatttttcttatgcatattatcaatggatcattcaaccactcggatgtttataaatggttttaattgctagttgatta |
5522169 |
T |
 |
Q |
143 |
tcatttcttttaagggtagttgattaccatttgtcattttggtttggtggcatttgttattttgatgtcttttatgtaacttttagctattgcttcatct |
242 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
5522168 |
tcatttcttttaagggtagttgattaccatttgtcattttggtttggtggcattttttattttgatgtcttttatgtaacttttagctattgcttcttct |
5522069 |
T |
 |
Q |
243 |
c |
243 |
Q |
|
|
| |
|
|
T |
5522068 |
c |
5522068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 44 - 101
Target Start/End: Original strand, 26478691 - 26478748
Alignment:
Q |
44 |
tagattaagtctaaagctaaggatttttcttatgcatattatcaaaggatcattcaac |
101 |
Q |
|
|
|||||||||||||||| ||| ||||||||||||| || |||||| ||| |||||||| |
|
|
T |
26478691 |
tagattaagtctaaagttaatgatttttcttatgattactatcaatggagcattcaac |
26478748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University