View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0740_low_133 (Length: 264)

Name: NF0740_low_133
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0740_low_133
NF0740_low_133
[»] chr8 (1 HSPs)
chr8 (43-243)||(5522068-5522268)
[»] chr4 (1 HSPs)
chr4 (44-101)||(26478691-26478748)


Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 43 - 243
Target Start/End: Complemental strand, 5522268 - 5522068
Alignment:
43 atagattaagtctaaagctaaggatttttcttatgcatattatcaaaggatcattcaaccagtcggatgtttataaatggttttaattgctagttgatta 142  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||    
5522268 atagattaagtctaaagctaaggatttttcttatgcatattatcaatggatcattcaaccactcggatgtttataaatggttttaattgctagttgatta 5522169  T
143 tcatttcttttaagggtagttgattaccatttgtcattttggtttggtggcatttgttattttgatgtcttttatgtaacttttagctattgcttcatct 242  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||    
5522168 tcatttcttttaagggtagttgattaccatttgtcattttggtttggtggcattttttattttgatgtcttttatgtaacttttagctattgcttcttct 5522069  T
243 c 243  Q
    |    
5522068 c 5522068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 44 - 101
Target Start/End: Original strand, 26478691 - 26478748
Alignment:
44 tagattaagtctaaagctaaggatttttcttatgcatattatcaaaggatcattcaac 101  Q
    |||||||||||||||| ||| |||||||||||||  || |||||| ||| ||||||||    
26478691 tagattaagtctaaagttaatgatttttcttatgattactatcaatggagcattcaac 26478748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3871 times since January 2019
Visitors: 4823