View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_138 (Length: 261)
Name: NF0740_low_138
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_low_138 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 30 - 178
Target Start/End: Complemental strand, 34053109 - 34052961
Alignment:
Q |
30 |
cttgcaaccaaagttgcgaaaaacagaagctgttctgacataggaagtaccaatggaccaagtgttgtgatgttggttttgagtgcttctccggcaaccg |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
34053109 |
cttgcaaccaaagttgcgaaaaacagaagctgttctgacataggaagtaccaatggaccaagtgttgtgatgttggttttcagtgcttctccggcaaccg |
34053010 |
T |
 |
Q |
130 |
ccattaaatcttttgagagtgatacaccaattgatttcttctcatcttc |
178 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34053009 |
ccattaaatcttttgagagtgatacaccaattgatttcttctcatcttc |
34052961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 57 - 157
Target Start/End: Complemental strand, 15239383 - 15239283
Alignment:
Q |
57 |
agctgttctgacataggaagtaccaatggaccaagtgttgtgatgttggttttgagtgcttctccggcaaccgccattaaatcttttgagagtgatacac |
156 |
Q |
|
|
|||||||| |||||||| || || ||||| || | |||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
T |
15239383 |
agctgttccgacataggtaggactaatggtcctaatgttgtgatgtttgttttgagtgcttctccggcaacagccattaggtcttttgagagtgatacac |
15239284 |
T |
 |
Q |
157 |
c |
157 |
Q |
|
|
| |
|
|
T |
15239283 |
c |
15239283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4540 times since January 2019
Visitors: 4836