View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0740_low_139 (Length: 259)

Name: NF0740_low_139
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0740_low_139
NF0740_low_139
[»] chr5 (2 HSPs)
chr5 (1-84)||(23143525-23143608)
chr5 (174-249)||(23143390-23143464)


Alignment Details
Target: chr5 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 23143608 - 23143525
Alignment:
1 tagttttataaaaatttcttaataacattgataatgcataattctgaatacaaaaatatgcaagtaaaatcctctttgttagat 84  Q
    ||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||    
23143608 tagttttataaaaatctcttaataatattgataatgcataattccgaatacaaaaatatgtaagttaaatcctctttgttagat 23143525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 174 - 249
Target Start/End: Complemental strand, 23143464 - 23143390
Alignment:
174 tttagtgctgagaatattttcat-caagtttaatccttttctctgtaccatagtcaggatttattaatttatctgtg 249  Q
    |||||| || ||||||||||||| ||||||||| ||||  |||||||||||||||||||||||||||||||||||||    
23143464 tttagttcttagaatattttcattcaagtttaaccctt--ctctgtaccatagtcaggatttattaatttatctgtg 23143390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4206 times since January 2019
Visitors: 4829