View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_140 (Length: 258)
Name: NF0740_low_140
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_low_140 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 258
Target Start/End: Original strand, 42216862 - 42217104
Alignment:
Q |
16 |
atgaagttgacaccatcagcaatggcctcatcaaagccagcaagcatgtccatgtcactgcacccaatggtccaacaaactttatacattgcaatacgtg |
115 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
42216862 |
atgaagttgacaccatcagcaatggcctcatcaaagccagcaagcatgtccatgtcactgcacccaatggtccaacaaactttatacattgcaatgcgtg |
42216961 |
T |
 |
Q |
116 |
ctgatgggacaccgccacgggcattgcctttaccaatgccataaagacttgcacccctcaccactgatccagccgctgtcgacgaagtgtgagtgccatg |
215 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
42216962 |
ctgatgggacaccgccacgggcattgcctttaccaatgccataaagacttgcacctctcaccactgatccagctgctgtcgacgaagtgtgagtgccatg |
42217061 |
T |
 |
Q |
216 |
gccctgatcatcaaccggacttgggttctcgatggttggacca |
258 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
42217062 |
gccctgatcatccaccggacttgggttctcgatggttggacca |
42217104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University