View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_143 (Length: 252)
Name: NF0740_low_143
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_low_143 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 111 - 215
Target Start/End: Original strand, 22526901 - 22527005
Alignment:
Q |
111 |
gtcattattatggtcaaaagacatttattatggtcaaaataaaactcatttgtaggagaactttaaaagaacgttcgtcaacaaattgacaagaagtttt |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
T |
22526901 |
gtcattattatggtcaaaagacatttattatggtcaaaataaaactcatttgtaggagaactttaaaagaacgttcgtcaacaaattgaccaaaagttta |
22527000 |
T |
 |
Q |
211 |
aaaaa |
215 |
Q |
|
|
||||| |
|
|
T |
22527001 |
aaaaa |
22527005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 16 - 94
Target Start/End: Original strand, 22526771 - 22526849
Alignment:
Q |
16 |
gggttaagacctttgtgttttatttaactatgaactcatttataggagaactttaaaagacattataatcaagtctttc |
94 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22526771 |
gggttaagacctttgtgttttatttaactatgaactcatttataggagaactttaaaagacattataatcaagtctttc |
22526849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 115 - 156
Target Start/End: Original strand, 22521467 - 22521508
Alignment:
Q |
115 |
ttattatggtcaaaagacatttattatggtcaaaataaaact |
156 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
22521467 |
ttattatagtcaaaagacatttattatggtcaaaataaaact |
22521508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2961 times since January 2019
Visitors: 4805