View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0740_low_154 (Length: 250)

Name: NF0740_low_154
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0740_low_154
NF0740_low_154
[»] chr3 (1 HSPs)
chr3 (1-237)||(40582374-40582610)


Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 40582374 - 40582610
Alignment:
1 cttggaatttgatgctattctatcttcattataacggtgttgtaaatttaggaatgcaatttcggtccttggatcatgattggtgattttaacaaggttc 100  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40582374 cttggaatttgatgttattctatcttcattataacggtgttgtaaatttaggaatgcaatttcggtccttggatcatgattggtgattttaacaaggttc 40582473  T
101 gcaattgcataaaaatatctggtgggaacttcaatttgtctgaggacaatcttgtctctcagatgtttgatgcttgtggggtcgtagacttagacacaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40582474 gcaattgcataaaaatatctggtgggaacttcaatttgtctgaggacaatcttgtctctcagatgtttgatgcttgtggggtcgtagacttagacacaat 40582573  T
201 tggtggcatctttagttggaggaaaagttctcaatat 237  Q
    |||||||||||||||||||||||||||||||||||||    
40582574 tggtggcatctttagttggaggaaaagttctcaatat 40582610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3659 times since January 2019
Visitors: 4816