View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_161 (Length: 239)
Name: NF0740_low_161
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_low_161 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 45548712 - 45548473
Alignment:
| Q |
1 |
aatatgatgttataagggatacagaaaagcatatccttagtatacttctggatgagatcgccaaagaatattgcacattcaaggagcgctgattgaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548712 |
aatatgatgttataagggatacagaaaagcatatccttagtatacttctggatgagatcgccaaagaatattgcacattcaaggagcgctgattgaatat |
45548613 |
T |
|
| Q |
101 |
gacaaccatactatggaagttttttatg-tatttgcaatacaattttgttggttgtaagtttgtaactggtgaggagttctgaacagcaagttttcatta |
199 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548612 |
gacaaccatactatgaaagttttttatgttatttgcaatacaattttgttggttgtaagtttgtaactggtgaggagttctgaacagcaagttttcatta |
45548513 |
T |
|
| Q |
200 |
gaaagaagagtttcctactttattaagttactataaaact |
239 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45548512 |
gaaagaagagtttcctcctttattaagttactataaaact |
45548473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2998 times since January 2019
Visitors: 4805