View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_166 (Length: 230)
Name: NF0740_low_166
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_low_166 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 223
Target Start/End: Original strand, 12285392 - 12285598
Alignment:
Q |
17 |
gagatcctatcgattcttctatttgctcttgactccaaatattttgtttagcctactatacctaaatatattttaccttaccttagcctcattataacct |
116 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
12285392 |
gagatcctatcgattcttctatttgctcttgactccaaatattttgtttagcctactatacctaaatatattttaccttacgttagcctcattataacct |
12285491 |
T |
 |
Q |
117 |
ttaaagacttctaaaatgtgtatgatcgtacttggctttgaatgacaatttaaagtatctccaagtttataggaaaatgcattagtatgttgattgagtg |
216 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12285492 |
ttaaagacttctaaaatgtgtatggtcgtacttggctttgaatgacaatttaaaatatctccaagtttataggaaaatgcattagtatgttgattgagtg |
12285591 |
T |
 |
Q |
217 |
agcgcct |
223 |
Q |
|
|
||||||| |
|
|
T |
12285592 |
agcgcct |
12285598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University