View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_170 (Length: 220)
Name: NF0740_low_170
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_low_170 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 36916146 - 36915937
Alignment:
| Q |
1 |
tacattttgtaacttttgtaaaatcacgagcgagtcaacgtgattataaaatacctacatgattataacataccttcggtaatatcaaatattcacttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36916146 |
tacattttgtaacttttgtaaaatcacgagcgagtcaacgtgattataacatacctacatgattataacataccttcggtaatatcaaacattcacttaa |
36916047 |
T |
|
| Q |
101 |
gttatttcttatcaagagggtcattcaagatgctataacttctcctaggtttatgtaaatatatctcacctcccctctgttttatcaaactacaataact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36916046 |
gttatttcttatcaagagggtcattcaagatgctataacttctcctaggtttatgtaaatatatctcacctcccctctgttttatcaaactacaataact |
36915947 |
T |
|
| Q |
201 |
cccctctctg |
210 |
Q |
| |
|
||||| |||| |
|
|
| T |
36915946 |
cccctttctg |
36915937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 189
Target Start/End: Complemental strand, 36916394 - 36916326
Alignment:
| Q |
121 |
tcattcaagatgctataacttctcctaggtttatgtaaatatatctcacctcccctctgttttatcaaa |
189 |
Q |
| |
|
||||| ||| |||| |||| |||||| ||||||| ||||||||| |||||||||||| ||| |||||| |
|
|
| T |
36916394 |
tcattgaagttgctctaacctctccttggtttatttaaatatataccacctcccctctatttcatcaaa |
36916326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 189
Target Start/End: Original strand, 24551300 - 24551342
Alignment:
| Q |
147 |
aggtttatgtaaatatatctcacctcccctctgttttatcaaa |
189 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
24551300 |
aggtttatgtaaatatatccaacctcccctctgttttctcaaa |
24551342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3750 times since January 2019
Visitors: 4818