View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_174 (Length: 211)
Name: NF0740_low_174
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_low_174 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 24 - 211
Target Start/End: Complemental strand, 44879865 - 44879678
Alignment:
| Q |
24 |
agtgtatcgtatattgaattttatagtaaagaggaaggagtgaataggaaatttcatctctgaaattgtaactatcggtcaaatttgtctctgattttac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44879865 |
agtgtatcgtatattgaattttatagtaaagaggaaggagtgaataggaaatttcatctctgaaattgtaactatcggtcaaatttgtctctgattttac |
44879766 |
T |
 |
| Q |
124 |
gcaccggcaacttccctatggtggtccttatgttaagtttagttgttacacagaatgatgtggcacattaatgaagatgttgtaattc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44879765 |
gcaccggcaacttccctatggtggtccttatgttaagtttagttgttacacagaatgatgtggcacattaatgaagatgttgtaattc |
44879678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University