View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_176 (Length: 206)
Name: NF0740_low_176
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_low_176 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 1841297 - 1841197
Alignment:
| Q |
1 |
tgtctgagaaattcattgcactttcagccactattcccggcttgagcaaggtaaatttgtcactagtttcatcgggtccattattcgtataacatatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
1841297 |
tgtctgagaaattcattgcactttcagccactattcccggcttgagcaaggtaaatttgtcactagtttcatcggatccattattcgtataatatatttt |
1841198 |
T |
 |
| Q |
101 |
g |
101 |
Q |
| |
|
| |
|
|
| T |
1841197 |
g |
1841197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 1823976 - 1823912
Alignment:
| Q |
1 |
tgtctgagaaattcattgcactttcagccactattcccggcttgagcaaggtaaatttgtcacta |
65 |
Q |
| |
|
||||||| ||||||||||||||||| || |||||||| || ||||||||||||||||||| |||| |
|
|
| T |
1823976 |
tgtctgaaaaattcattgcactttcggctactattcctggattgagcaaggtaaatttgtaacta |
1823912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University